I have answered it every way I know how. The original data is not altered. It's just there. The original files and the original DNA is still there (in this case, on swabs that are preserved).
You are missing the point. Nothing is altered. Whose word is that, even? Did a geneticists say it? No, they did not.
If I draw a picture of you, I do not alter you. You are still there. Same with PROFILES. They are snapshots of the genome and each photographer does it differently. All are based on reality. Reality is not altered. DNA is not altered by the profiling process. In this case, it's also safely preserved in BK's body, as well as in the lab replication/analysis. It has been COPIED but not altered (altering DNA is an incredibly difficult thing to do requiring advanced technologies beyond the reach of any forensic lab).
But labs like Parabon and Othram never see that actual real DNA. They don't have blood from people. They don't even have saliva (well, they can collect it - but 90 percent of what they do is based on people's results from Ancestry and 23andme - where you do pay money to have your saliva analyzed).
The database is not altered. What database do you even mean? If you get blood test results that show you are anemic, is that result a "database"? DNA is a long string of graphical points (or letters, used as abbreviations). It's like a giant book that can be read by knowledgeable geneticists who then use computer programs to aid their reading (because no one understands the whole genome - each of these groups we're talking about is only studying a tiny fraction of the data).
All they are doing is basically putting different lenses on a kind of mental microscope. When you look through a microscope, nothing is altered in the slide (if you follow scientific procedures).
Nothing in the data is altered. The DNA submitted to Othram for the match (Kohberger's dad's dna) is still precisely what it was before (both physically and in its representation).
I can put it a slightly different way. In order to analyze SNP's, we MUST use computers. Some locations in the genome have up to 6000 different alleles that could be in the slot (and more are being found continually). But all Othram or Gedmatch are trying to do is MATCH one person's DNA (without any regard to what is being matched) to another person's DNA. In order to make this fast and not take years to get results, they FOCUS their lens on 600,000 SNP's (that's a lot). These are individual base pairs in the genome.
The FBI lens FOCUSES on only 18 (producing way more matches - as intended, as their goal is to continually scrutinize already known felons to make sure they're not committing new crimes). They don't care if they have to go to some guy on probation and make him account for where he was. They like doing that. I may be wrong about the exact number (it used to be 16, then it was 18, I haven't checked this year).
You want a MACRO lens for the FBI person, and you want a MICRO lens for matching two different people. You're playing a card game. One game has 18 cards, the other has 600,000 cards. The total deck is much bigger. The deck never changes (except by mutations in sex cells - which happen every generations but are of no value whatsoever in making familial connections, because that's the one region of the individual's genome where they will likely match no one).
If you take a snapshot of what you seem to want to call a "database" (to me it's not a database if it's just data - it's a database when you have individual files - and those individual files in the database CANNOT be altered or rewritten - that's fraudulent, unscientific and further, it would only change the letters in one version of a file).
The REAL Kohberger genome is now in the possession of the State of Idaho in several forms. Someone looking at the letters/graphical points that represent that genome, on a computer, at the other side of the country, is NOT altering any data. Couldn't get their work done properly if they did. They are simply looking for matches, just like that kids' game. And since it's super tedious and boring work, they use computers to do it (faster) for them.
My computer is not altering its basic software as I type. Nothing I type in this text box will alter my operating system.
Anyway - what do you even mean by "database." Can you say what words you use to refer to actual DNA? And to an actual print-out of a human's DNA? I would say "DNA" and "DNA results." The ISL said they were 'lucky' to find enough complete DNA on the use point of the sheath (a common place to find complete DNA) that they could run several swabs. Each gave a complete human genome - they just didn't know who it was.
So are you claiming the lab altered the RECORD of the DNA (for what reason? why do you think that? I understand general mistrust of science, if that's your reason, but of course, I can't really have hope for a sensible conversation about it, if that's your plan).
OR, are you thinking that they altered the DNA itself? (Which I am telling you is not possible for the lab to do). Genetic engineering is a completely different thing. And since we now know that the DNA actually DID match Bryan Kohberger, we also know that from start to finish, the DNA was complete; it was compared to many other people's DNA at Othram (match game) and got matches. One of the closer matches (all partial of course, as BK wasn't in that database as a known individual) was a Kohberger, which immediately rang a bell to the investigators, as he was already on their radar.
Then they got Dad's DNA, ran it against the BK DNA (already run by ISL; with its record being entirely digital - NO ONE can actually see DNA with their eyes - except using electronic microscopes or similar, but even then, only biochemical analysis shows the SNP's). Dad's DNA matched at about 50% (proof of paternity - no one else in your world or mine is going to match you at 50% except your parents; keep in mind that these types of matches are ultimate run using the entire long set of graph points/letters (nucleotides) from the original DNA.
Database software. It compares. It does not alter. It wouldn't work (at all) if it altered and Othram and Gedmatch and 23andme and Ancestry would all go out of business. It just proves a READER that a human can use to understand - unlike the REAL results, which take years and years and teams of scientists to begin to ponder.
Here is one graphical representation of those base pairs (SNPs), and this is how it looks when we do it in the lab (this is a common staining technique under electron micrscope and represents a FRACTION of a person's actual DNA):
View attachment 458239
That's a stock photo from Getty. As you can see, you can't make heads or tails of it. Nor can I. This is just one computer-assisted way of lining up the original DNA results. But to actually multiple this picture by 1000 and then expect a human to figure out comparisons is impossible. We can't do it.
And here's a picture of the results of a paternity test:
View attachment 458240
Now, I know that those colors represent nucleotides, introns and extrons. So does the computer. In this case, we have selected a subset of the original data to compare (SNP's which are the only places that two individuals vary). Each of those colors represents a long list of even smaller data points (ACTG and more).
When we ask the computer to compare the above picture with someone else's paternity test, it will take us a method and quite some time to be able to see the differences (and similarities). It will not leap out at us. There's too many data points. Although, I've watched people work (and you can see Spencer Wells do it in his film Journey of Man, free on Youtube, at about the 45 minute mark - when he's in India). He's an expert in one chromosome. He's able to look at something like this (he prefers mathematical representations) and quickly see certain variations he's looking for. Page 216 of the below article shows how one single element in the chart above (purine) can be represented mathematically in relationship to other parts of DNA:
Keep reading to get to how to look at ONE gene mathematically (it's pages and pages - hopefully you can get a sense of what the computer is actually doing - it's doing math, quickly).
Here's what ONE gene (the gene that makes our blood red) looks like across species in its basic form:
Table 2. Listing of the bases of the first exon in the beta globin gene for the eight speciesmentioned. (Note: All the papers have used 90 bases for the rabbit exon 1 but it should be 92bases. Here we report the corrected sequence.)HUMAN (92 bases):ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAG
GOAT (86 bases):ATGCTGACTGCTGAGGAGAAGGCTGCCGTCACCGGCTTCTGGGGCAAGGTGAAAGTGGATGAAGTTGGTGCTGAGGCCCTGGGCAG
OPOSSUM (92 bases):ATGGTGCACTTGACTTCTGAGGAGAAGAACTGCATCACTACCATCTGGTCTAAGGTGCAGGTTGACCAGACTGGTGGTGAGGCCCTTGCCAG
GALLUS (92 bases):ATGGTGCACTGGACTGCTGAGGAGAGGCAGCTCATCACCGGCCTCTGGGGCAAGGTCAATGTGGCCGAATGTGGGGCCGAAGCCCTGGCCAG
LEMUR (92 bases):ATGACTTTGCTGAGTGCTGAGGAGAATGCTCATGTCACCTCTCTGTGGGGCAAGGTGGATGTAGAGAAAGTTGGTGGCGAGGCCTTGGGCAG
MOUSE (92 bases):ATGGTGCACCTGACTGATGCTGAGAAGGCTGCTGTCTCTTGCCTGTGGGGAAAGGTGAACTCCGATGAAGTTGGTGGTGAGGCCCTGGGCAG
RABBIT (92 bases):ATGGTGCATCTGTCCAGTGAGGAGAAGTCTGCGGTCACTGCCCTGTGGGGCAAGGTGATTGTGGAAGAAGTTGGTGGTGAGGCCCTGGGCAG
RAT (92 bases):ATGGTGCACCTAACTGATGCTGAGAAGGCTACTGTTAGTGGCCTGTGGGGAAAGGTGAACCCTGATAATGTTGGCGCTGAGGCCCTGGGCAG
How quick are you at finding similarities there? I find the letters far easier to compare than the colors, but that's just me. Are you noticing all the similarities?
A computer that can mathematically deduce not only the comparisons but the actual biochemistry that these letters are indicating is the main tool for analysis. I noticed immediately that the lemur gene was closer to human than the mouse.
Analysis with a computer does not change the original data. It too knows that the first three letters of this particular gene (and the last three - they're call CODONS, and they are read by the body to produce every single thing that keeps you alive and makes your body what it is) are the same. Hmmm. So, across several species, there are commonalities in this gene. But what about the biochemical similarity? THere are multiple codons for each amino acid (and some don't code for amino acids at all). The computer knows this system and can immediately give the formula for the protein (and it better make hemoglobin!! And - it turns out, all of these genes DO make hemoglobin, through very similar biochemical processes).
50 years ago, we'd have only said, "it's hemoglobin, from a mammal." Now we can tell if it's Lemur hemoglobin or Human (and I have no clue what a Gallus is, maybe a type of rabbit?) Anyway, we now know that our closest living relatives of the group studied here is...well, can you figure it out? Or would you prefer that someone else ran this through an analyzer and computed the actual similarities and differences?
So that's what we're up to, in our labs. My work has to do with how to develop field methods for studying these things out in the real world. In humans. I don't study rats or lemurs. And I know quite a bit about the human genome, after 50 years in the field - BUT, I know almost nothing about any one particular SNP, because each of them would require me to take about a decade of the equivalent of post-doctoral study to be familiar enough to have a conversation with the people who are studying this.
Othram hires experts in genomic study PLUS computer experts and has managed to build one of the more robust SNP study databases (the datacomes from papers like the ones I'm quoting - that's the database). The incoming DNA from subjects is then compared to it.
(Sorry for the very long post - everyone here is so intelligent, but, we were born at different times - I know there is one younger WSer who already knows more about all this than I do, but may not have years of trying explain these methods both to grant writers, to students, to LE and to the general public). She may not have the patience either - I really feel it's important in True Crime for all of us to *try* and understand the science.